View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14392_high_68 (Length: 238)
Name: NF14392_high_68
Description: NF14392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14392_high_68 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 39 - 227
Target Start/End: Complemental strand, 41170634 - 41170446
Alignment:
| Q |
39 |
tgagactagcaatggtaaaaacaggtatttagaattcaaacaaatgatcaatatatcaataaagagagaccgtgacttctcaattctccttcatgtcgac |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41170634 |
tgagactagcaatggtaaaaacaggtatttagaattcaaacaaatgatcaatatatcaataaagagagaccgtgacttctcaattctccttcatgtcgat |
41170535 |
T |
 |
| Q |
139 |
gtgtgtggaacaaattggtaggttgtctgttgtgttacgacttccaggttagttatgccactttgaatattgttgtttggaagtataat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41170534 |
gtgtgtggaacaaattggtaggttgtctgttgtgttacaacttccaggttagttatgccactttgaatattgttgtttggaagtataat |
41170446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University