View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14392_high_69 (Length: 238)

Name: NF14392_high_69
Description: NF14392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14392_high_69
NF14392_high_69
[»] chr4 (1 HSPs)
chr4 (38-209)||(34962686-34962856)


Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 38 - 209
Target Start/End: Original strand, 34962686 - 34962856
Alignment:
38 gtttacagtggagagaaggttgctccggttggattctttagcaagtatccggctcttaccaccggttttttcttcttcacttggtaagtcacgatgatga 137  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||    
34962686 gtttacagtggagagaaggttgctccggttggattctttagcaagtatccggctcttaccaccggttttttcttcttcacttggtaagtcacgtcgatga 34962785  T
138 aacactgatacatacaggaacatgacatagacactgacagagacacgaacattacccagacactaacatata 209  Q
    |||| ||||||||||| || ||||||||||||| | | ||||||||||||||||||||||||||||||||||    
34962786 aaca-tgatacatacacgaccatgacatagacatttatagagacacgaacattacccagacactaacatata 34962856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University