View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14392_high_70 (Length: 231)
Name: NF14392_high_70
Description: NF14392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14392_high_70 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 16 - 215
Target Start/End: Complemental strand, 43562306 - 43562105
Alignment:
| Q |
16 |
aatatagttaactaagtcggttagatgattaatttagattacgttgaaatttacatagaattgaatta-ccatatctttaaacatgtgcctttg-gtgtg |
113 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||| ||||| ||||| |
|
|
| T |
43562306 |
aatatagttaactcagtcggttagatgattaatttagattacgttgaaatttacatagaattgaattaaccataattttaaccatgtgtctttgtgtgtg |
43562207 |
T |
 |
| Q |
114 |
acaagtgtacgaaaaagggtatagatgtatcgtcattattgatatgacaaaatattttctcgtataaaaagcaatttcaccaacactatttctcctcaac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43562206 |
acaagtgtacgaaaaagggtatagatgtatcgtcattattgatatgacaaaatattttctcgtataaaaagcaatttcaccaacactatttctcctcaac |
43562107 |
T |
 |
| Q |
214 |
ac |
215 |
Q |
| |
|
|| |
|
|
| T |
43562106 |
ac |
43562105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University