View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14392_low_24 (Length: 460)
Name: NF14392_low_24
Description: NF14392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14392_low_24 |
 | |
|
| [»] scaffold0617 (2 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 314; Significance: 1e-177; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 342
Target Start/End: Complemental strand, 45342679 - 45342338
Alignment:
| Q |
1 |
agtgactacttgaattgcaccattgatctcaagtcgaatgttcccttttcccattaccgccattttggaatcgttgccgagctttaccgagtgtttgaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342679 |
agtgactacttgaattgcaccattgatctcaagtcaaatgttcccttttcccattaccaccattttggaatcgttgccgagctttaccgagtgtttgaaa |
45342580 |
T |
|
| Q |
101 |
tcttcatcaatggtagaaaaccactgcttgtttccgcacatgtgattgctacaaccggagtcgaggaaccatgtatcttcttgttttgaattggtagcat |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| | |
|
|
| T |
45342579 |
tcttcattaatggtagaaaaccactgcttgtttccgcacatgtgattgctacaaccggagtcgagaaaccatatatcttcttgttttgaattggtagctt |
45342480 |
T |
|
| Q |
201 |
caacaaaggacatgagcagcatctcttcttcttcatcaatttcagcatagtttgcactttccttccatcttgggcattcatattggaaatgtcctagttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342479 |
caacaaaggacatgagcagcatctcttcttcttcatcaatttcaacatagtttgcactttccttccatcttgggcattcatattggaaatgtcctagttt |
45342380 |
T |
|
| Q |
301 |
gtgacatttaaaacactccactatggctttgtttgcaaattg |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342379 |
gtgacatttaaaacactccactatggctttgtttgcaaattg |
45342338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 405 - 456
Target Start/End: Complemental strand, 45342275 - 45342224
Alignment:
| Q |
405 |
cattttgatcttcatgtgaaaccttcaacgcttgctcatctctagtgtctct |
456 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45342275 |
cattttgatcttcatgtgaaaccttcaacgcttgctcatctctagtgtctct |
45342224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0617 (Bit Score: 29; Significance: 0.0000006; HSPs: 2)
Name: scaffold0617
Description:
Target: scaffold0617; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 275 - 315
Target Start/End: Original strand, 3274 - 3314
Alignment:
| Q |
275 |
cattcatattggaaatgtcctagtttgtgacatttaaaaca |
315 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||| |
|
|
| T |
3274 |
cattcatattggaaatgtcccaatttgtgacatttgaaaca |
3314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0617; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 275 - 315
Target Start/End: Original strand, 8718 - 8758
Alignment:
| Q |
275 |
cattcatattggaaatgtcctagtttgtgacatttaaaaca |
315 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||| |
|
|
| T |
8718 |
cattcatattggaaatgtcccaatttgtgacatttgaaaca |
8758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 275 - 315
Target Start/End: Complemental strand, 14244708 - 14244668
Alignment:
| Q |
275 |
cattcatattggaaatgtcctagtttgtgacatttaaaaca |
315 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||| |
|
|
| T |
14244708 |
cattcatattggaaatgtcccaatttgtgacatttgaaaca |
14244668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University