View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14392_low_40 (Length: 368)
Name: NF14392_low_40
Description: NF14392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14392_low_40 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 1 - 368
Target Start/End: Original strand, 43666560 - 43666933
Alignment:
| Q |
1 |
acatgtttttgtttaaggtgttaatgtgtttgagcttaattttgatttttgaggttggttgcactaaggggatttgtatatttataaggtggttggattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43666560 |
acatgtttttgtttaaggtgttaatgtttttgagcttaattttgatttttgaggttggttgcactaaggggatttgtatatttataaggtggttggattt |
43666659 |
T |
 |
| Q |
101 |
gttgtctttctctgattgtggcatgaaattacaattatcaattattatataa------taatgtgttaaatagtgtagctataggtagctttgtaatcag |
194 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43666660 |
gttgtctttctcttattgtggcatgaaattacaattatcaattattatataataataataatgtgctaaatagtgtagctataggtagctttgtaatcag |
43666759 |
T |
 |
| Q |
195 |
aatattcctagaaggttatggttagatatagggtatttttctgtctttaatgttgttaccccttggagatagatgtcttcatttacaagtatatggatac |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43666760 |
aatattcctagaaggttatggttagatatagggtatttttctgtctttaatgttgttaccccttggagatagatgtcttcatttacaagtatatggatac |
43666859 |
T |
 |
| Q |
295 |
tccactaatttaaccttttgtaaattgcctttcaaatcaagatgggtccattattaaatttcaatcccacctta |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43666860 |
tccactaatttaaccttttgtaaattgcctttcaaatcaagatgggtccattattaaatttcaatcccacctta |
43666933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University