View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14392_low_51 (Length: 330)
Name: NF14392_low_51
Description: NF14392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14392_low_51 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 320
Target Start/End: Original strand, 26855004 - 26855323
Alignment:
| Q |
1 |
aaacaagcacacattcttcatgtgtaatttcgaacgttcatgtttattatcaaaaatattcatgcatgactcggctattccctgcaaatcgtttgctaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26855004 |
aaacaagcacacattcttcatgtgtaattttgaatgttcatgtttattatcaaaaaaattcatgcatgactcggctattccctgcaaatcgtttgctaca |
26855103 |
T |
|
| Q |
101 |
aacaccaaaaaatgaatggcaacaacatgcacattctattccttctcgtgttctacaagaacaaattttgtgtcaagcacaaaactttcaccctaatggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26855104 |
aacaccaaaaaatgaatggcaacaacatgcacattctattccttctcgtgttctacaagaacaaattttgtgtcaagcacaaaactttcaccctaatggc |
26855203 |
T |
|
| Q |
201 |
atattttatggtgacaatcccttaagtcacacattctcagcacttttgttgcacctcgttcttgtcaccaccatcacccgcattgttcgtttcattctta |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26855204 |
atattttatggtgacaatcccttaagtcacacattctcagcacttctgttgcacctcgttcttgtcaccaccatcacccgcattgttcgtttcattctta |
26855303 |
T |
|
| Q |
301 |
agcctctcaaacaacctatg |
320 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
26855304 |
agcctctcaaacaacctatg |
26855323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University