View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14392_low_59 (Length: 287)
Name: NF14392_low_59
Description: NF14392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14392_low_59 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 16 - 253
Target Start/End: Complemental strand, 2510251 - 2510027
Alignment:
| Q |
16 |
atttaatctgtgacaatttttctataatcatttataatttgaagtttaatggaattggtctctataagtttcatttccaactttaacattgcagcaaaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2510251 |
atttaatctgtgacaatttttctataatcatttataatttgaagtttaatggaattggtctctataagtttcatttccaactt-aacattgcagcaaaat |
2510153 |
T |
 |
| Q |
116 |
aataatgtgacaatcctttcaatgaggatgagattgatcaaattatctcttttttgtgacagtgttttttcaggataaaattgttttgaaatgtggcaac |
215 |
Q |
| |
|
|| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2510152 |
tat------------ctctcaatgaggatgagattgatcaaattatctctcttttgtgacagtgttttttcaagataaaattgttttgaaatgtggcaac |
2510065 |
T |
 |
| Q |
216 |
ggacaatagtaaatatgtttaagttagcaagtgttcac |
253 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2510064 |
ggacaatagtaaatacgtttaagttagcaagtgttcac |
2510027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University