View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14392_low_62 (Length: 263)
Name: NF14392_low_62
Description: NF14392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14392_low_62 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 13 - 263
Target Start/End: Original strand, 43482385 - 43482635
Alignment:
| Q |
13 |
actatttagttatgggacttatatggacaggacttagacataagtactcatttaaatgttaacggtttacaaaaatcatttatgatatgtatataaattt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43482385 |
actatttagttatgggacttatatggacaggacttagacataagtactcatttaaatgttaacggtttacaaaaatcatttatgatatgtatataaattt |
43482484 |
T |
 |
| Q |
113 |
ttgaggaatgttatgtatataaattgtttatgcaaagttttctcttagccaatgaatgaacatttaagtgtctgtttgaattgatggtgcaaatgataga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43482485 |
ttgaggaatgttatgtatataaattgtttatgcaaagttttctcttagccaatgaatgaacatttaagtgtctgtttgaattgatggtgcaaatgataga |
43482584 |
T |
 |
| Q |
213 |
attcttgcgaaccaccacaattttgacaaaattatactttagaacttcaac |
263 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43482585 |
attcttgtgaaccaccacgattttgacaaaattatactttagaacttcaac |
43482635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University