View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14392_low_69 (Length: 247)
Name: NF14392_low_69
Description: NF14392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14392_low_69 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 19 - 228
Target Start/End: Complemental strand, 28525284 - 28525074
Alignment:
| Q |
19 |
actaccaagcaatcccttttctcaataattttctcaataacctctctttgataaggccgaaaactcaaaaacccgaagtaatcctgaataatacaagtta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28525284 |
actaccaagcaatcccttttctcaataattttctcaataacctctctttgataaggtcgaaaactcaaaaacccgaagtaatcctgaataatacaagtta |
28525185 |
T |
 |
| Q |
119 |
caaacatatcagcattgatcaatctcatagcattcaaatactcaaattctctgtagcaccaacacttctgatggaagatatgt---gtgtcggacacatg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| ||||| | ||||| |
|
|
| T |
28525184 |
caaacatatcagcattgatcaatctcatagcattcaaatactcaaattcgatgtagcaccaacacttctgatggaagacatgtctggtgtc--agacatg |
28525087 |
T |
 |
| Q |
216 |
tcgttgtccgaca |
228 |
Q |
| |
|
||||||||||||| |
|
|
| T |
28525086 |
tcgttgtccgaca |
28525074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University