View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14392_low_72 (Length: 240)
Name: NF14392_low_72
Description: NF14392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14392_low_72 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 16 - 223
Target Start/End: Complemental strand, 30391045 - 30390838
Alignment:
| Q |
16 |
aatatttgggtacaatgtgactctctgattgtggttaaagcttttcatcaggatgtgggagtgccttggcggatgcacaacagatggttcaactgtaaga |
115 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30391045 |
aatatttgggtagaatgtgactctctgattgtggttaaagcttttcatcaggatgtggtagtgccttggcggatgcacaacagatggttcaactataaga |
30390946 |
T |
 |
| Q |
116 |
tccttgctagacagatgggatgcatccgttctcatactcctcgagagggaaatatggtggctgatgtccttgctaagaatgggcaagggctttctatgta |
215 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30390945 |
tccttgctagacagatggaatgcatctgttctcatactcctcgagagggaaatatggtggctgatgtccttgctaagaatgggcaaggtctttctatgta |
30390846 |
T |
 |
| Q |
216 |
ctcttctc |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
30390845 |
ctcttctc |
30390838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University