View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14392_low_74 (Length: 238)
Name: NF14392_low_74
Description: NF14392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14392_low_74 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 38 - 209
Target Start/End: Original strand, 34962686 - 34962856
Alignment:
| Q |
38 |
gtttacagtggagagaaggttgctccggttggattctttagcaagtatccggctcttaccaccggttttttcttcttcacttggtaagtcacgatgatga |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34962686 |
gtttacagtggagagaaggttgctccggttggattctttagcaagtatccggctcttaccaccggttttttcttcttcacttggtaagtcacgtcgatga |
34962785 |
T |
 |
| Q |
138 |
aacactgatacatacaggaacatgacatagacactgacagagacacgaacattacccagacactaacatata |
209 |
Q |
| |
|
|||| ||||||||||| || ||||||||||||| | | |||||||||||||||||||||||||||||||||| |
|
|
| T |
34962786 |
aaca-tgatacatacacgaccatgacatagacatttatagagacacgaacattacccagacactaacatata |
34962856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University