View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14392_low_76 (Length: 230)
Name: NF14392_low_76
Description: NF14392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14392_low_76 |
 |  |
|
| [»] scaffold0036 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0036 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 21802 - 22016
Alignment:
| Q |
1 |
gtacccaactaaaaaattaaattgtgctctatttccaaagatggaaatacctttatttggtacaacaaacaagcaatacgagttgttgccaaccttaaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| || |||| |
|
|
| T |
21802 |
gtacccaactaaaaaattaaattgtgctctatttccaaagatggaaatacctttatttggtacgacaaacaagcaatacgagtggttgccaagctcaaca |
21901 |
T |
 |
| Q |
101 |
actaagttctgaggtttaagggtaacatcagctctcgtaaaatgaaacacaaaattagggaattttgttatatcttcaaaggtgaagcaaaaggtatatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21902 |
actaagttctgaggtttaagggtaacatcagctctcgtaaaatgaaacacaaaattagggaactttgttatatctccaaaggtgaagcaaaaggtatatg |
22001 |
T |
 |
| Q |
201 |
gggattgaggatctt |
215 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
22002 |
gggatggaggatctt |
22016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 23 - 215
Target Start/End: Original strand, 13786 - 13978
Alignment:
| Q |
23 |
tgtgctctatttccaaagatggaaatacctttatttggtacaacaaacaagcaatacgagttgttgccaaccttaacaactaagttctgaggtttaaggg |
122 |
Q |
| |
|
|||||| |||||||||||||||||| | | || ||||| | ||||||||||||||||||||||||| | ||| ||| |||||||||||||||| |
|
|
| T |
13786 |
tgtgctatatttccaaagatggaaagatcattggatggtatggccaacaagcaatacgagttgttgccaagaacaccaagtaatttctgaggtttaaggg |
13885 |
T |
 |
| Q |
123 |
taacatcagctctcgtaaaatgaaacacaaaattagggaattttgttatatcttcaaaggtgaagcaaaaggtatatggggattgaggatctt |
215 |
Q |
| |
|
||||||| |||| ||| ||||||||||| ||||||||||| |||| || |||| |||||||||||||||||||| |||| ||| ||||||||| |
|
|
| T |
13886 |
taacatcggctcccgtgaaatgaaacacgaaattagggaactttgctagatctccaaaggtgaagcaaaaggtaaatggtgatggaggatctt |
13978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University