View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14392_low_77 (Length: 229)
Name: NF14392_low_77
Description: NF14392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14392_low_77 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 76 - 208
Target Start/End: Original strand, 42225307 - 42225441
Alignment:
| Q |
76 |
acaaaaacataattgtaggtcaatatgctttt--ctctctctcaaaatactcataacatttttgttagtattatccatgttggaacgtgacacatttttg |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42225307 |
acaaaaacataattgtaggtcaatatgcttttttctctctctcaaaatactcataacatttttgttagtattatccatgttggaacgtgacacatttttg |
42225406 |
T |
|
| Q |
174 |
tcttataactttggaaatatcttatttgtttcttt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42225407 |
tcttataactttggaaatatcttatttgtttcttt |
42225441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 17 - 58
Target Start/End: Original strand, 42225244 - 42225285
Alignment:
| Q |
17 |
atataatgatgaaatggtatttcagtgaacataattatatgg |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42225244 |
atataatgatgaaatggtatttcagtgaacataattatatgg |
42225285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University