View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14392_low_81 (Length: 209)
Name: NF14392_low_81
Description: NF14392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14392_low_81 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 17564390 - 17564276
Alignment:
| Q |
1 |
catcatgtccaatagagcaacaatccctcatttgttttaacttgttcaatcaaagtctcctcatgttgtttctgcattttcttttcaagttcttcatgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17564390 |
catcatgtccaatagagcaacaatccctcatttgttttaacttgttcaatcaaagtctcctcatgttgtttctgcattttcttttcaagttcttcatgct |
17564291 |
T |
 |
| Q |
101 |
tcctaaaagtctatt |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
17564290 |
tcctaaaagtctatt |
17564276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 118 - 190
Target Start/End: Original strand, 17542033 - 17542105
Alignment:
| Q |
118 |
tgttgctcttgcatcttcttctctaaagcttctagctttctgatgagctcaacttgaatctcattatgcctat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17542033 |
tgttgctcttgcatcttcttctctaaagcttctagctttctgatgagctcaacttgaatctcattatgcctat |
17542105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 143 - 188
Target Start/End: Complemental strand, 24494255 - 24494210
Alignment:
| Q |
143 |
aagcttctagctttctgatgagctcaacttgaatctcattatgcct |
188 |
Q |
| |
|
|||||||| |||||||||| | |||| ||||||||||||||||||| |
|
|
| T |
24494255 |
aagcttcttgctttctgataatctcagcttgaatctcattatgcct |
24494210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 13306115 - 13305954
Alignment:
| Q |
1 |
catcatgtccaatagagcaacaatccct-catttgttttaacttgttcaatcaaagtctcctcatgttgtttctgcattttcttttcaagttcttcatgc |
99 |
Q |
| |
|
|||||| ||||| |||||| ||||||| ||||||| || |||| ||| ||||| |||||||||||| |||| ||| || |||| || ||||| ||| |
|
|
| T |
13306115 |
catcatctccaagagagcagcaatcccagcatttgtctttgcttgctcagccaaagactcctcatgttgcttcttcatatttctttctagctcttcttgc |
13306016 |
T |
 |
| Q |
100 |
ttcctaaaagtctattgatgttgctcttgcatcttcttctctaaagcttctagctttctgat |
161 |
Q |
| |
|
||||| | || || | |||||||| ||||| || ||||| ||||||||| |||||||||| |
|
|
| T |
13306015 |
ttccttagagactctaagtgttgctcctgcatatttttctccaaagcttcttgctttctgat |
13305954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University