View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14393_high_26 (Length: 257)

Name: NF14393_high_26
Description: NF14393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14393_high_26
NF14393_high_26
[»] chr5 (1 HSPs)
chr5 (4-242)||(194985-195225)


Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 4 - 242
Target Start/End: Original strand, 194985 - 195225
Alignment:
4 tcaggagcaggttcttgcacaccggtcaatcgcttgctttgttactcactgtggctggaactcgttgatggaggctattgcctctggagtgccggttgtg 103  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
194985 tcaggagcaggttcttgcacaccggtcaatcgcttgctttgttactcactgtggctggaactcgtcgatggaggctattgcctctggagtgccggttgtg 195084  T
104 gcgttcccacaatggggtgaccaagtgacgaatgccaa--gtacttggttgatgtgtatggagttgggattggaatgtgcaagggtgaagctgcaaacga 201  Q
    ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
195085 gcgttcccacaatggggtgaccaagtgacgaatgccaagtgtacttggttgatgtgtatggagttgggattggaatgtgcaagggtgaagctgcaaacga 195184  T
202 attgataaacagagatgaggtcaacaagtgtttgttggagg 242  Q
    ||||||||||||||||||||| |||||||||||||||||||    
195185 attgataaacagagatgaggttaacaagtgtttgttggagg 195225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University