View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14393_high_26 (Length: 257)
Name: NF14393_high_26
Description: NF14393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14393_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 4 - 242
Target Start/End: Original strand, 194985 - 195225
Alignment:
| Q |
4 |
tcaggagcaggttcttgcacaccggtcaatcgcttgctttgttactcactgtggctggaactcgttgatggaggctattgcctctggagtgccggttgtg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
194985 |
tcaggagcaggttcttgcacaccggtcaatcgcttgctttgttactcactgtggctggaactcgtcgatggaggctattgcctctggagtgccggttgtg |
195084 |
T |
 |
| Q |
104 |
gcgttcccacaatggggtgaccaagtgacgaatgccaa--gtacttggttgatgtgtatggagttgggattggaatgtgcaagggtgaagctgcaaacga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
195085 |
gcgttcccacaatggggtgaccaagtgacgaatgccaagtgtacttggttgatgtgtatggagttgggattggaatgtgcaagggtgaagctgcaaacga |
195184 |
T |
 |
| Q |
202 |
attgataaacagagatgaggtcaacaagtgtttgttggagg |
242 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
195185 |
attgataaacagagatgaggttaacaagtgtttgttggagg |
195225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University