View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14393_low_11 (Length: 423)
Name: NF14393_low_11
Description: NF14393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14393_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 31 - 401
Target Start/End: Complemental strand, 42173769 - 42173398
Alignment:
| Q |
31 |
tcagcaacaacgggagaactgttgttaaccagatcgtccgacttccaaaagttctagtgaaacaaaacatctctgacatgaattttaaccaccgaaacag |
130 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42173769 |
tcagcaacaacgggaaaactgttgttaaccagatcgtccgacttccaaaagttctagtgaaacaaaacatctctgacatgaattttaaccaccaaaacag |
42173670 |
T |
 |
| Q |
131 |
actcagaaggctctgatcttagtgtgtgaagacaaaaaaccattggaaggtgacgtgtggcttacatgcaccaatgaggggcgtagaggctggtggcgtg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42173669 |
actcagaaggctctgatcttagtgtgtgaagacaaaaaaccattggaaggtgacgtgtggcttacatgcaccgatgaggggcgtagaggctggtggcgtg |
42173570 |
T |
 |
| Q |
231 |
tgagaacgtgtaca-aggtgaatggcggcgaggttctagccggtcttgaggcgacaattctaatggtatgattaccaaagaaaaaactgcagtggaaggc |
329 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42173569 |
tgagaacgtgtacacaggtgaatggcggcgaggttctagccggtcttgaggcgacaattctaatggtatgattaccaaagaaaaaactgcagtggaaggc |
42173470 |
T |
 |
| Q |
330 |
ttccaaacgcgtgcgagcggtaattgtaactggtaacaaacagacgacaatgaacaatgatgatccaaacaa |
401 |
Q |
| |
|
|| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42173469 |
ttacaaacgtgtgcgagcggtaattgtaactggtaacaaacagacgacaatgaacaatgatgatccaaacaa |
42173398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University