View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14393_low_16 (Length: 345)
Name: NF14393_low_16
Description: NF14393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14393_low_16 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 14 - 345
Target Start/End: Original strand, 40966880 - 40967216
Alignment:
| Q |
14 |
atgcatattgattctgaacggtttttgatgaatctttagcggttgtaagtttgaatttgcataaccagttatagtaggcaggatataatgcatgcgtgtg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
40966880 |
atgcatattgattctgaacggtttttgatgaatctttagcgggtgtaagtttgaatttgcataaccagctatagtaggcaggatataatgcgtgcgtgtg |
40966979 |
T |
 |
| Q |
114 |
cgtgtgcgtgatgggtgatgaaatatttgtgctatataacgaattaacgatatctctttctttggaaataatgttatacagaggtttatctatcttctgg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40966980 |
cgtgtgcgtgatgggtgatgaaatatttgtgctatataacgaattaacggtatctctttctttggaaataatgttatacagaggtttatctatcttctgg |
40967079 |
T |
 |
| Q |
214 |
ttaggtaattcggtcttgttgttaatatttaatat-----gaggtttgtatccttcattcatatctagtactaatactagtactggaatactaggatagg |
308 |
Q |
| |
|
||| |||||||| |||||||||||||||||||| | ||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
40967080 |
ttatgtaattcgctcttgttgttaatatttaatttaatttgaggtttgtttccttcattcatatctagtactattactagtactggtatactaggatagg |
40967179 |
T |
 |
| Q |
309 |
gtgttaggctaaatttcagaatttagaatcatttgat |
345 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40967180 |
gtgttaggctaaatttcagaatttagaaccatttgat |
40967216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University