View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14393_low_19 (Length: 315)
Name: NF14393_low_19
Description: NF14393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14393_low_19 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 15 - 315
Target Start/End: Complemental strand, 39930133 - 39929836
Alignment:
| Q |
15 |
caaagggagagtttgatatttattttggtagatacgaatttcttgttttacggataaagtcattaatggaattgtaatcggttaatcacttttttgtatt |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | || |
|
|
| T |
39930133 |
caaaaggagagtttgatatttattttggtagatacgaatttcttgttttacggataaagtcattaatgggattgtaatcggttaatcacttttttat-tt |
39930035 |
T |
|
| Q |
115 |
ttggttagctaaaggttaatcacttatttgagctgtatatgtatatatttttcagtatttcttcttttcgagttgaccaaaatgacttgcttgtccttat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39930034 |
ttggttagctaaaggttaatcacttatttgagctgtat--gtatatatttttcagtatttcttcttttcgagttgaccaaaatgacttgcttgtccttat |
39929937 |
T |
|
| Q |
215 |
caccacaccactccgaattcattggacaaaagaaggaaaaaagttgaaggataaagaaaaggatgcgtatggagcttgaaaaatatgaatgcaaattaaa |
314 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39929936 |
caccacatcactccgaattcataggacaaaagaaggaaaaaagttgaaggataaagaaaaggatgcgtatggagcttgaaaaatatgaatgcaaattaaa |
39929837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University