View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14393_low_20 (Length: 307)
Name: NF14393_low_20
Description: NF14393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14393_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 16 - 294
Target Start/End: Original strand, 22527972 - 22528248
Alignment:
| Q |
16 |
taaagttgaagaagttgcatgaatcattctatgtctacattgttgaacaagattccgacggatatatctttgttctgtttgtagataattcgtattgata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22527972 |
taaagttgaagaagttgcatgaatcattctatgtctacattgttgaacaa--ttccgacagatatatctttgttctgtttgtagataattcgtattgata |
22528069 |
T |
 |
| Q |
116 |
ttcagattgaagagtaagatgctgacaaattattaatttcttgcaacatgttgcagcctttgatggcaatcaggttcaattctttgaattttgataccct |
215 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22528070 |
ttcagattgtagagtaagatgctgacaaattattaatttcttgcaaaatgttgcagcctttgatggcaatcaggttcaattctttgaattttgataccct |
22528169 |
T |
 |
| Q |
216 |
aggagaatcaagagaatcgtctcgtgtaaaaatttgacaaagcctttaaaattattaagatatcatcctctttgtatat |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22528170 |
aggagaatcaagagaatcgtctcgtgtaaaaatttgacaaagcctttaaaattattaagatatcatcctctttgtatat |
22528248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University