View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14393_low_22 (Length: 281)

Name: NF14393_low_22
Description: NF14393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14393_low_22
NF14393_low_22
[»] chr1 (2 HSPs)
chr1 (1-106)||(23302525-23302630)
chr1 (200-265)||(23302365-23302430)
[»] chr2 (2 HSPs)
chr2 (1-105)||(16149431-16149535)
chr2 (200-265)||(16149629-16149694)
[»] chr6 (2 HSPs)
chr6 (1-106)||(4652038-4652144)
chr6 (200-265)||(4652238-4652303)


Alignment Details
Target: chr1 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 23302630 - 23302525
Alignment:
1 atgttttgtggacggcatttcaaaagcaatagcttgagtcatccatggatcttgatcagtaatgattggctttggaggcttcttcatgagagtaacaaaa 100  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
23302630 atgttttgtggatggcatttcaaaagcaatagcttgagtcatccatggatcttgatcagtaatgattgtctttggaggcttcttcatgagagtaacaaaa 23302531  T
101 gtctgg 106  Q
    ||||||    
23302530 gtctgg 23302525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 200 - 265
Target Start/End: Complemental strand, 23302430 - 23302365
Alignment:
200 gagagacatgtatatgaactaactttcattaaccattgaaatgtagacaatgtttcatttcgaatg 265  Q
    |||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||    
23302430 gagagagatgtatatgaacttactttcattaaccattgaaatgtagacactgtttcatttcgaatg 23302365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 16149431 - 16149535
Alignment:
1 atgttttgtggacggcatttcaaaagcaatagcttgagtcatccatggatcttgatcagtaatgattggctttggaggcttcttcatgagagtaacaaaa 100  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
16149431 atgttttgtggatggcatttcaaaagcaatagcttgagtcatccatggatcttgatcagtaatgattgtctttggaggcttcttcatgagagtaacaaaa 16149530  T
101 gtctg 105  Q
    |||||    
16149531 gtctg 16149535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 200 - 265
Target Start/End: Original strand, 16149629 - 16149694
Alignment:
200 gagagacatgtatatgaactaactttcattaaccattgaaatgtagacaatgtttcatttcgaatg 265  Q
    |||||| ||||||||||||| ||||||||||||||||||||||||||||  |||||||||||||||    
16149629 gagagagatgtatatgaacttactttcattaaccattgaaatgtagacaccgtttcatttcgaatg 16149694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 4652038 - 4652144
Alignment:
1 atgttttgtggacggcatttcaaaagcaatagcttgagtcatccatggatcttgatcagtaatgattggc-tttggaggcttcttcatgagagtaacaaa 99  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
4652038 atgttttgtggatggcatttcaaaagcaatagcttgagtcatccatggatcttgatcagtaatgattggcttttggaggcttcttcatgagagtaacaaa 4652137  T
100 agtctgg 106  Q
    |||||||    
4652138 agtctgg 4652144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 200 - 265
Target Start/End: Original strand, 4652238 - 4652303
Alignment:
200 gagagacatgtatatgaactaactttcattaaccattgaaatgtagacaatgtttcatttcgaatg 265  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4652238 gagagagatgtatatgaactaactttcattaaccattgaaatgtagacaatgtttcatttcgaatg 4652303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University