View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14393_low_23 (Length: 278)
Name: NF14393_low_23
Description: NF14393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14393_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 161 - 261
Target Start/End: Complemental strand, 27444360 - 27444260
Alignment:
| Q |
161 |
tcaagcggatgttcactgtctcaatgaaatagtttcacatccttgtcattatagagatgaaagtgttccatcgagtagtattcaaaataatgtcgaagct |
260 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27444360 |
tcaagcggatgttcacagtctcaatgaaatagtttcacatccttgtcattatagagatgaaaatgttccatcgagtagtattcaaaataatgtcgaagct |
27444261 |
T |
 |
| Q |
261 |
g |
261 |
Q |
| |
|
| |
|
|
| T |
27444260 |
g |
27444260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 70 - 161
Target Start/End: Complemental strand, 27444486 - 27444395
Alignment:
| Q |
70 |
tcagaagaacaaatttccggttgcaagattttttggcataatttctggtattgtttttggggtcgcctgcttaatggtagttgcatgggttt |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27444486 |
tcagaagaacaaatttccggttgcaagattttttggcataatttctggtattgtttttggggtcgcctgcttaatggtagttgcatgggttt |
27444395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University