View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14394_high_17 (Length: 255)
Name: NF14394_high_17
Description: NF14394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14394_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 8039190 - 8038945
Alignment:
| Q |
1 |
agtgttcgtgtttgtgtctgtgcttcatagacggcaggacaccccataatcacatttaagttggttaaatgtttccattcttaaagctaggttacttgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8039190 |
agtgttcgtgtttgtgtctgtgcttcatagacggcaaaacaccccataatcacgtttaagttggttaaatgtttccattcttaaagctaggttacttgga |
8039091 |
T |
 |
| Q |
101 |
gtaaatttttcgattcaacacggtgttgtcaaatggcagcgctcgctacaagaaaaatctgcgttactggcagccaaaagccctcggaagtacnnnnnnn |
200 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |||||||| |
|
|
| T |
8039090 |
gtaaatttttcgaatcaacacagtgttgtcaaatggcagcgctcgctacaagaaaaatctgcattaccggcagccaaaagcccttggaagtacaaaaaaa |
8038991 |
T |
 |
| Q |
201 |
nctgccggtaatcccaatgcataccagagtttggacaaagtattat |
246 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
8038990 |
actgccggtaatgccaatgcatactagagtttggacaaagtattat |
8038945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University