View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14394_low_16 (Length: 283)
Name: NF14394_low_16
Description: NF14394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14394_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 10 - 267
Target Start/End: Complemental strand, 3064035 - 3063778
Alignment:
| Q |
10 |
tctattttcccatatcgtaagcctatttgcacaaagtgatatcggttacatgattcaacacatatcataatgttctgtcataagcttttttcttcttaat |
109 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3064035 |
tctattttcccatatcgtaaacctatttgcacaaagtgatatcggttacatgattcaacacatatcataatgttctgtcataagtttttttcttcttaat |
3063936 |
T |
 |
| Q |
110 |
cttagttagttaatgataaattggctgattaaaaacattttgtagggggtagtggaaaatgtaggaacgacaattcgaagcatgtacaaaacaataaagt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3063935 |
attagttagttaatgataaattggctgattaaaaacattttgtagggggtagtggaaaatgtaggaacgacaattcgaagcatgtacaaaacaataaagt |
3063836 |
T |
 |
| Q |
210 |
atcctcaagcatggaagccttctctttacatgttcctttcccttgctcttaatgtaac |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3063835 |
atcctcaagcatggaagccttctctttacatgttcctttcccttgctcttaatgtaac |
3063778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University