View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14394_low_25 (Length: 223)
Name: NF14394_low_25
Description: NF14394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14394_low_25 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 9 - 223
Target Start/End: Complemental strand, 33102699 - 33102485
Alignment:
| Q |
9 |
acatcatcagcaccaaaattagaatgtctcggagcatagcccatcatagagtagaaatccgtatgattaaaattagaccctcgcggcgtcggattccggg |
108 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33102699 |
acatcattagcaccaaaattagaatgtctcggagcatagcccatcatagagtagaaatccgtatgattaaaattagaccctcgcggcgtcggattccggg |
33102600 |
T |
|
| Q |
109 |
aagaactcaaactataaatctctgctccggtgagattcgacggccgcggagtcatcataaaagatctccgggaagcgtttgattttctgacatgaacatg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33102599 |
aagaactcaaactataaatctctgctccggtgagattcgacggccgtggagtcatcataaaagatctccgggaagcgtttgattttctgacatgaacatg |
33102500 |
T |
|
| Q |
209 |
aagcttaccatcatc |
223 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33102499 |
aagcttaccatcatc |
33102485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University