View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14395_high_21 (Length: 394)
Name: NF14395_high_21
Description: NF14395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14395_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 20 - 384
Target Start/End: Complemental strand, 2907744 - 2907383
Alignment:
| Q |
20 |
tcttactttcaagaaatcaccatttgcgttagaaaggtcgattgcatatcgttttgctctgccatctatgctagccctcaattagttaaccgcaagcagt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2907744 |
tcttactttcaagaaatcaccatttgcgttagaaaggtcgattgcatatcgttttgccctgccatctatgctagccctcaattagttaaccacaagcagt |
2907645 |
T |
|
| Q |
120 |
tatggaattatattattgctcttcgccaagaaatttcgagtctttaggttatgatagaagacttcagtgaagtttttctcccttctgagataaagagagg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2907644 |
tatggaattatattattgctcttcgccaagatatttcgagtctttaggttatgatagaagacttcaacgaagtttttctcccttctgagataaagagagg |
2907545 |
T |
|
| Q |
220 |
tattatctttatagttaaacagattctaaaattttctatcatgatgaagcagtgtaatcttattaaccttggagctacatgtaatagctatacctagact |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2907544 |
---tatctttatagttaaacagattctaaaattttctatcatgatggagcagtgtaatcttattaaccttggagctacatgtaatagctatacctagact |
2907448 |
T |
|
| Q |
320 |
cgcaaggagagagagattaagaagattgctaaattgttggtcagagcccttggtgattgtctgtg |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2907447 |
cgcaaggagagagagattaagaagattgctaaattgttggtcagagcccttggtgattgtctgtg |
2907383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 105
Target Start/End: Complemental strand, 36738010 - 36737941
Alignment:
| Q |
36 |
tcaccatttgcgttagaaaggtcgattgcatatcgttttgctctgccatctatgctagccctcaattagt |
105 |
Q |
| |
|
||||||||||| ||| |||||| ||||| || | |||||||||||| || |||| |||||||||| |||| |
|
|
| T |
36738010 |
tcaccatttgcattaaaaaggttgattgtatgtggttttgctctgctatttatggtagccctcaactagt |
36737941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University