View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14395_high_28 (Length: 351)
Name: NF14395_high_28
Description: NF14395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14395_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 19 - 329
Target Start/End: Complemental strand, 5549223 - 5548914
Alignment:
| Q |
19 |
ccaatgggtgattggcaccgtgcgtccagttggatccagggtgtcaacatcctgcaccacaagagctaggctcttggttttgggaggaacgttatgccat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5549223 |
ccaatgggtgattggcaccgtgcgtccagttggatccacggtgtcaacatcctgcaccaaaagagctaggctcttggttttgggaggaacgttaagccat |
5549124 |
T |
 |
| Q |
119 |
tctagaggtggagatatgttccactttgaacctacaccttcatgtgtgtaatatcttggtaatttgacacctccttctttgtcaattgctggtgaaacca |
218 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5549123 |
tctagaggtggagatatattccactttgaacctacgccttcatgtgtgtaatatcttggtaatttgacacctccttctttgtcaattgctggtgaaacca |
5549024 |
T |
 |
| Q |
219 |
acctgaattctttgctagccatggatagcaaagtaaatatgcttattatttgtgcactttgttgcgtaattttgcaaatgctataattgattcatttgcg |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
5549023 |
acctgaattctttgctagccatggatagcaatgtaaatatgcttactatttgtgcactttgttgcgt-attttgcaaatgctataattgattaatttgcg |
5548925 |
T |
 |
| Q |
319 |
gtgtgtttgta |
329 |
Q |
| |
|
|| ||||||| |
|
|
| T |
5548924 |
ttgggtttgta |
5548914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University