View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14395_high_29 (Length: 347)
Name: NF14395_high_29
Description: NF14395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14395_high_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 214
Target Start/End: Original strand, 32581827 - 32582024
Alignment:
| Q |
17 |
tttcttatgacagaggcaaaaaggagcaaatgctagtaaagaaagaagcatgagaaagctcaaagaatttgccattgttcttttttcaatatcactcaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32581827 |
tttcttatgacagaggcaaaaaggagcaaatgctagtaaagaaagaagcatgagaaagctcaaagaatttgccattgttcttttttcaatatcactcaga |
32581926 |
T |
 |
| Q |
117 |
gaaagatatgagagtagttgaagaagagaagttctcaaaattgattgtatgagtgatgtgttggaaaatggtatttatagagaagagctcgggtccct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32581927 |
gaaagatatgagagtagttgaagaagagaagttctcaaaattgattgtatgagtgatgtgttggaaaatggtatttatagagaagagctcgggtccct |
32582024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 285 - 334
Target Start/End: Original strand, 32582096 - 32582145
Alignment:
| Q |
285 |
tggagttggtaactatctaatttaaaaatccatgttaaagtggaagagaa |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32582096 |
tggagttggtaactatctaatttaaaaatccatgttaaagtggaagagaa |
32582145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University