View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14395_high_30 (Length: 345)

Name: NF14395_high_30
Description: NF14395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14395_high_30
NF14395_high_30
[»] chr8 (1 HSPs)
chr8 (46-123)||(37974664-37974741)


Alignment Details
Target: chr8 (Bit Score: 74; Significance: 7e-34; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 46 - 123
Target Start/End: Original strand, 37974664 - 37974741
Alignment:
46 tttacattgttgctccaattgcacaaaccaaaatttattatcatgtatgaggttgattaaattaaatatgatcttgtc 123  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
37974664 tttacattgttgctccaattgcacaaaccaaaatttattatcatgtatgaggttgattaaattaaatacgatcttgtc 37974741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University