View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14395_high_30 (Length: 345)
Name: NF14395_high_30
Description: NF14395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14395_high_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 74; Significance: 7e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 46 - 123
Target Start/End: Original strand, 37974664 - 37974741
Alignment:
| Q |
46 |
tttacattgttgctccaattgcacaaaccaaaatttattatcatgtatgaggttgattaaattaaatatgatcttgtc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37974664 |
tttacattgttgctccaattgcacaaaccaaaatttattatcatgtatgaggttgattaaattaaatacgatcttgtc |
37974741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University