View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14395_high_35 (Length: 303)
Name: NF14395_high_35
Description: NF14395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14395_high_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 13 - 286
Target Start/End: Original strand, 32325231 - 32325504
Alignment:
| Q |
13 |
aatatttaagataaagtgataaaccaaacatgtaatgaaaaataatatgccgcttcaggttttaagacttattgcctagtacatgaccctactagacaca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32325231 |
aatatttaagataaagtgataaaccaaacatgtaatgaaaaataatatgccgcttcaggttttaagacttattgcctagtacatgaccctactagacaca |
32325330 |
T |
|
| Q |
113 |
tatatcatgattggatccaagtgatctatctgctgcacttgcacccataagcttttaactcacgctgcttaaaaaacttctttttatcattgacacctgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32325331 |
tatatcatgattggatccaagtgatctatctgctgcacttgcacccataagcttttaactcacgctgcttaaaaaacttctttttatcattgacacctgt |
32325430 |
T |
|
| Q |
213 |
gttgcaggttaggtcgttcatctgaattcttaatatatggtcagtggcaacagcggaatgcaattattgaggcc |
286 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32325431 |
gttgcaggttaggtcgtacatctgaattcttaatatatggtcagtggcaacagcggaatgcaattattgaggcc |
32325504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University