View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14395_low_40 (Length: 295)
Name: NF14395_low_40
Description: NF14395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14395_low_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 15 - 275
Target Start/End: Original strand, 30498946 - 30499206
Alignment:
| Q |
15 |
aatatctccaagtttaagatgcctactactgcaaaggttctgtttttgatatcttggtatgtaatgttatatcaatcttttgcaaattttgttgctagtt |
114 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30498946 |
aatatctccaagtttaagatgcctaccactgcaaaggttctgtttttgatatcttggtatgtaatgttatatcaatcttttgcaaattttgttgctagtt |
30499045 |
T |
|
| Q |
115 |
gttactttaaaatgtgaattattagactnnnnnnngactaaattgttggtaatgtttatcaggcttagctttggagttgtagttatattgttgattgctg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30499046 |
gttactttaaaatgtgaattattagactaaaaaaagactaaattgttggtaatgtttatcaggcttagctttggagttgtagttatattgttgattgctg |
30499145 |
T |
|
| Q |
215 |
caacaagcatgagcagaaggcagctctatgggaaaggatggttgaatggtgagtgctttct |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30499146 |
caacaagcatgagcagaaggcagctctatgggaaaggatggttgaatggtgagtgctttct |
30499206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 174 - 271
Target Start/End: Complemental strand, 10445554 - 10445457
Alignment:
| Q |
174 |
caggcttagctttggagttgtagttatattgttgattgctgcaacaagcatgagcagaaggcagctctatgggaaaggatggttgaatggtgagtgct |
271 |
Q |
| |
|
||||||||||||||||||| |||||| || | |||| ||||||||||||||||| |||||||| ||||||| ||| |||||||||||||| |||| |
|
|
| T |
10445554 |
caggcttagctttggagttacagttattttactaattgttgcaacaagcatgagcaaaaggcagccctatggggcaggttggttgaatggtgaatgct |
10445457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University