View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14395_low_49 (Length: 243)
Name: NF14395_low_49
Description: NF14395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14395_low_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 6e-52; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 116 - 227
Target Start/End: Complemental strand, 42079012 - 42078901
Alignment:
| Q |
116 |
caggattaaaggattttccaaaccttcagttggagctgcttcgagacaaaacattttccaaacaatgtgaacatgttattcttttcaaaaattatagttc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42079012 |
caggattaaaggattttccaaaccttcagttggagctgcttggagacaaaacattttccaaaccatgtgaacatgttattcttttcaaaaattatagttc |
42078913 |
T |
 |
| Q |
216 |
agatgtataaag |
227 |
Q |
| |
|
|||||||||||| |
|
|
| T |
42078912 |
agatgtataaag |
42078901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 18 - 118
Target Start/End: Complemental strand, 42079142 - 42079042
Alignment:
| Q |
18 |
gcaaaggtacaactctaattcctggagtcaagtcaacagcacaaacagaggaaaatgtgggtgctcttggttggcgtctttcatcagaccagctgcttca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| | ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42079142 |
gcaaaggtacaactctaattcctggagtcaagtcaatagcaaaggcagaggaaaatttgggtgctcttggttggcgtctttcatcagaccagctgcttca |
42079043 |
T |
 |
| Q |
118 |
g |
118 |
Q |
| |
|
| |
|
|
| T |
42079042 |
g |
42079042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 118
Target Start/End: Complemental strand, 42081571 - 42081471
Alignment:
| Q |
18 |
gcaaaggtacaactctaattcctggagtcaagtcaacagcacaaacagaggaaaatgtgggtgctcttggttggcgtctttcatcagaccagctgcttca |
117 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||| | ||||| ||||||||||| |||||||||| ||||||||||| || ||| || |||| ||||| |
|
|
| T |
42081571 |
gcaaaggtacaattccaattcctggagtcaagtcaataacacaagcagaggaaaatttgggtgctctgggttggcgtctctcctcaaacgagctacttca |
42081472 |
T |
 |
| Q |
118 |
g |
118 |
Q |
| |
|
| |
|
|
| T |
42081471 |
g |
42081471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University