View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14396_low_6 (Length: 269)
Name: NF14396_low_6
Description: NF14396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14396_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 12 - 252
Target Start/End: Complemental strand, 44960187 - 44959947
Alignment:
| Q |
12 |
atcatcattacaacatcaaatggggagttatctgatgcaatcaagtgcaggttcaattccagcaagtcatactcagattccggcaaatatatggatggtt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44960187 |
atcatcattacaacatcaaatggggagttatctgatgcaatcaagtgcaggttcaattccagcaagtcatactcagattccggcaaatatatggatggtt |
44960088 |
T |
 |
| Q |
112 |
gcaaattctaataaccaaataatgagtggtggtgatcctatatggacttttccgtcagtgaataatagtgctgctgctttgtatagaggagcagtttcaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44960087 |
gcaaattctaataaccaaataatgagtggtggtgatcctatatggacttttccgtcagtgaataatagtgctgctgctttgtatagaggagcagtttcaa |
44959988 |
T |
 |
| Q |
212 |
ctagtggtttgcattttatgaattttccacaacctatggct |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44959987 |
ctagtggtttgcattttatgaattttccacaacctatggct |
44959947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University