View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14397_high_7 (Length: 353)
Name: NF14397_high_7
Description: NF14397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14397_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 338
Target Start/End: Complemental strand, 7946687 - 7946349
Alignment:
| Q |
1 |
gattccaatccaaaaagaaaatcactaaagcctaaacatttaatggtaggacattttacacaaacagaattataccctaagcacannnnnnnnggcagga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7946687 |
gattccaatccaaaaagaaaatcactaaatcctaaacatttaatagtaggacattttacacaaacagaattataccctaagcacattttttttggcagga |
7946588 |
T |
 |
| Q |
101 |
caatcttttgagtgaaatcccatagtctgttgtatggccat-ttgtagctactattatgccctttcagctgcaaatgaacttccacttggagctctaaaa |
199 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7946587 |
caatcttttgagtgaaatccaatagtctgttgtatggccatattgtagctactattatgccctttcagctgcaaatgaacttccacttggagctctaaaa |
7946488 |
T |
 |
| Q |
200 |
gattcaacatgaccagcagtttttatagattcaccagctatgtctttttcatcagttttgtgtactgctaaatgtgcaagagccgctacgacatcatcca |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7946487 |
gattcaacatgaccagcagtttttatagattcaccagctatgtctttttcatcagttttgtgtactgctaaatgtgcaagagcctctacgacatcatcca |
7946388 |
T |
 |
| Q |
300 |
tgtacgggcgcgtgtcagcttcttcttgtagacacattg |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7946387 |
tgtacgggcgcgtgtcagcttcttcttgtagacacattg |
7946349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University