View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14397_low_16 (Length: 212)
Name: NF14397_low_16
Description: NF14397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14397_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 19 - 197
Target Start/End: Original strand, 50425293 - 50425471
Alignment:
| Q |
19 |
taaaagcaactataaaaaattaaccgaggatgaaagtattattttcgatctttattataagaaaataatccacgtttatttaatattcgatgcatgttgt |
118 |
Q |
| |
|
||||||| || |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
50425293 |
taaaagcgacaataaaaaattaatcgaggatgaaagtattattttcgatctttattataagaaaataaaccacgtttatttaatatttgatgcatgttgt |
50425392 |
T |
 |
| Q |
119 |
ctatattataaataaaatatatcaattatacaataaacataattttcttttcctataatagtgattgatagtagtaagt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50425393 |
ctatattataaataaaatatatcaattattaaataaacataattttcttttcctataatagtgattgatagtagtaagt |
50425471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University