View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14398_high_11 (Length: 305)
Name: NF14398_high_11
Description: NF14398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14398_high_11 |
 |  |
|
| [»] chr1 (19 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 19)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 16 - 305
Target Start/End: Complemental strand, 35192906 - 35192617
Alignment:
| Q |
16 |
atgtagagctttcaattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctctccattgcttggggtgatgatcgacgctattgga |
115 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35192906 |
atgtagagctttcaattggataggaagagtggaaaaaagtgttatatgcttgctgctagatctctctccattgcttggggtgatgatcgacgctattgga |
35192807 |
T |
 |
| Q |
116 |
actggatttctatgcctaattccaggttagcttagatattaagttttctattttttctcatgtcatgtgttaatcataatactattattttctattacca |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35192806 |
actggatttctatgcctaattctaggttagcttagatattaagttttctattttttctcatgtcatgtgttaatcataatactattattttctattacca |
35192707 |
T |
 |
| Q |
216 |
cccaatatattttcattaacagttatattattacgcctttatgaatacaaaatttagttgaggcaaatggataagtgtcaagtgaaacgc |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
35192706 |
cccaatatattttcattaacagttatattattacgcctttatgaatacaaaatttagttgaggcaaatggataagtgtccagtgatacgc |
35192617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 20 - 171
Target Start/End: Complemental strand, 35203242 - 35203090
Alignment:
| Q |
20 |
agagctttcaattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctctccattgcttggggtgatgatcgacgctattggaactg |
119 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| || ||||||||||| |
|
|
| T |
35203242 |
agagcattcaattggatagaaagagtggaaaaaagtgttacatgcttgctgctagatctctctccattgcttggggtaatgatgatcgatattggaactg |
35203143 |
T |
 |
| Q |
120 |
gatttctatgcctaattccaggttagcttagat-attaagttttctatttttt |
171 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
35203142 |
gattgctatgcctgattccaggttagcttagatctttaagttttctaattttt |
35203090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 20 - 147
Target Start/End: Complemental strand, 35272982 - 35272855
Alignment:
| Q |
20 |
agagctttcaattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctctccattgcttggggtgatgatcgacgctattggaactg |
119 |
Q |
| |
|
||||| ||||||| || |||||| |||||||||||||||| |||||| ||||||||||||| | |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
35272982 |
agagcattcaattagagagaaagagtggaaaaaagtgttacatgctttctgctagatctcttgcaattgtttggggtgatgatagacgctattggaactg |
35272883 |
T |
 |
| Q |
120 |
gatttctatgcctaattccaggttagct |
147 |
Q |
| |
|
||||||||||||| |||||||||||||| |
|
|
| T |
35272882 |
gatttctatgcctgattccaggttagct |
35272855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 20 - 143
Target Start/End: Complemental strand, 45526263 - 45526140
Alignment:
| Q |
20 |
agagctttcaattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctctccattgcttggggtgatgatcgacgctattggaactg |
119 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||| |||||||||| ||| |
|
|
| T |
45526263 |
agagctttcaattggatagaaagagtggaaaaaagtgttacatgcttgctgctagatctctccacattatttggggtgatgatgaccgctattggatctg |
45526164 |
T |
 |
| Q |
120 |
gatttctatgcctaattccaggtt |
143 |
Q |
| |
|
|| | |||||||| |||||||||| |
|
|
| T |
45526163 |
gactgctatgcctgattccaggtt |
45526140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 20 - 143
Target Start/End: Complemental strand, 35477056 - 35476933
Alignment:
| Q |
20 |
agagctttcaattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctctccattgcttggggtgatgatcgacgctattggaactg |
119 |
Q |
| |
|
||||| ||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |||||||||||||||||||| || ||||| ||||| |
|
|
| T |
35477056 |
agagccttcaattggatagaaagagtgggaaaaagtgttacatgcttgctgctagatctctcgccattgcttggggtgatgatgatcgatattgcaactg |
35476957 |
T |
 |
| Q |
120 |
gatttctatgcctaattccaggtt |
143 |
Q |
| |
|
|||| || | ||| |||||||||| |
|
|
| T |
35476956 |
gattgctgtacctgattccaggtt |
35476933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 20 - 143
Target Start/End: Complemental strand, 45534467 - 45534344
Alignment:
| Q |
20 |
agagctttcaattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctctccattgcttggggtgatgatcgacgctattggaactg |
119 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||| ||||||||||||||||||||| ||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
45534467 |
agagctttcaattagatagaaatagtgggaaaaagtgttacatgcttgctgctagatctctcgccattacttggggtgatgacaaccgctactggaactg |
45534368 |
T |
 |
| Q |
120 |
gatttctatgcctaattccaggtt |
143 |
Q |
| |
|
|||| |||||||| |||||||||| |
|
|
| T |
45534367 |
gattgctatgcctgattccaggtt |
45534344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 61 - 171
Target Start/End: Complemental strand, 35148949 - 35148839
Alignment:
| Q |
61 |
atgcttgctgctagatctctctccattgcttggggtgatgatcgacgctattggaactggatttctatgcctaattccaggttagcttagatattaagtt |
160 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||||| | ||||||||||||||||| ||||||| |
|
|
| T |
35148949 |
atgctttctgctagatctctcagcattgcttggggtgatgataagcgctattggaactggattaatatgcctgactccaggttagcttagatcttaagtt |
35148850 |
T |
 |
| Q |
161 |
ttctatttttt |
171 |
Q |
| |
|
||||||||||| |
|
|
| T |
35148849 |
ttctatttttt |
35148839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 20 - 147
Target Start/End: Original strand, 35295198 - 35295325
Alignment:
| Q |
20 |
agagctttcaattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctctccattgcttggggtgatgatcgacgctattggaactg |
119 |
Q |
| |
|
|||||||||||||||| |||||| |||| ||||||||||||||||||||||||||||||||| | ||| ||||||||| | ||| |||||||||| |
|
|
| T |
35295198 |
agagctttcaattggagagaaagagtgggaaaaagtgttatatgcttgctgctagatctctcactattaattggggtgactctgagcgccattggaactg |
35295297 |
T |
 |
| Q |
120 |
gatttctatgcctaattccaggttagct |
147 |
Q |
| |
|
||||||||||| | |||||||||||||| |
|
|
| T |
35295298 |
gatttctatgcatgattccaggttagct |
35295325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 20 - 145
Target Start/End: Complemental strand, 35213644 - 35213519
Alignment:
| Q |
20 |
agagctttcaattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctctccattgcttggggtgatgatcgacgctattggaactg |
119 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| || ||||| ||||| |
|
|
| T |
35213644 |
agagctttcaattggagagaaaaagtggaaaaaaatgttatatgcttgctgctagatctctcggcattgcttggggtgatgatgatcgatattgcaactg |
35213545 |
T |
 |
| Q |
120 |
gatttctatgcctaattccaggttag |
145 |
Q |
| |
|
|||| | ||||| |||| ||||||| |
|
|
| T |
35213544 |
gattgatgtgcctgattctaggttag |
35213519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 28 - 102
Target Start/End: Complemental strand, 35217025 - 35216951
Alignment:
| Q |
28 |
caattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctctccattgcttggggtgatgat |
102 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35217025 |
caattggatagaaagagtggaaaaaagtgttacatgctttctgctagatctctctccattgcttgcggtgatgat |
35216951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 16 - 99
Target Start/End: Complemental strand, 35228510 - 35228427
Alignment:
| Q |
16 |
atgtagagctttcaattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctctccattgcttggggtgat |
99 |
Q |
| |
|
|||||||| ||||||||||| |||||| ||||||| ||||||||||||||| ||||||||||||| ||||| ||||||||||| |
|
|
| T |
35228510 |
atgtagagttttcaattggagagaaagagtggaaagaagtgttatatgctttctgctagatctcttgccattacttggggtgat |
35228427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 8640376 - 8640313
Alignment:
| Q |
20 |
agagctttcaattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctctc |
83 |
Q |
| |
|
||||| |||||||||| |||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8640376 |
agagcgttcaattggacagaaagagtggaaaaaagtgttacatgcttgctgctagatctctctc |
8640313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 35222850 - 35222768
Alignment:
| Q |
20 |
agagctttcaattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctctccattgcttggggtgatgat |
102 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||| ||||||||||||||||||||| ||||| ||||| ||||||| |
|
|
| T |
35222850 |
agagcgttcaattggatagaaagagtggaaaaaagtgtgtcatgcttgctgctagatctctcgacattgattgggatgatgat |
35222768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 28 - 146
Target Start/End: Complemental strand, 35265412 - 35265294
Alignment:
| Q |
28 |
caattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctctccattgcttggggtgatgatcgacgctattggaactggatttcta |
127 |
Q |
| |
|
|||||||| |||||| |||||||||||||||| |||||| ||||||||||||| | |||| |||||||||| | | ||| |||||||||||| || |
|
|
| T |
35265412 |
caattggacagaaagagtggaaaaaagtgttacatgctttctgctagatctcttgcaattgtttggggtgatactaagcactactggaactggattcctt |
35265313 |
T |
 |
| Q |
128 |
tgcctaattccaggttagc |
146 |
Q |
| |
|
||||| ||||||||||||| |
|
|
| T |
35265312 |
tgcctgattccaggttagc |
35265294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 22 - 123
Target Start/End: Complemental strand, 35145287 - 35145186
Alignment:
| Q |
22 |
agctttcaattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctctccattgcttggggtgatgatcgacgctattggaactgga |
121 |
Q |
| |
|
|||||||||||| ||||| || || ||||||||||||| ||| || |||||||||||||| ||||||||||| |||||||| || ||||| ||||||| |
|
|
| T |
35145287 |
agctttcaattgaatagagagagtagaaaaaagtgttacatggtttctgctagatctctcgccattgcttggagtgatgatgatcgatattgcaactgga |
35145188 |
T |
 |
| Q |
122 |
tt |
123 |
Q |
| |
|
|| |
|
|
| T |
35145187 |
tt |
35145186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 35206478 - 35206425
Alignment:
| Q |
28 |
caattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctc |
81 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
35206478 |
caattggatagaaagagtggaaaaaagtgttacatgctttctgctagatctctc |
35206425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 251 - 291
Target Start/End: Complemental strand, 35203001 - 35202961
Alignment:
| Q |
251 |
cctttatgaatacaaaatttagttgaggcaaatggataagt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35203001 |
cctttatgaatacaaaatttagttgaggcaaatggataagt |
35202961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 16 - 81
Target Start/End: Complemental strand, 35249673 - 35249608
Alignment:
| Q |
16 |
atgtagagctttcaattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctc |
81 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||| | ||||| | | || ||||||||| |||| |
|
|
| T |
35249673 |
atgtagagctttcaattggataaaaagagtggaaaagactgttacacgttttctgctagatttctc |
35249608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 45 - 81
Target Start/End: Original strand, 19267391 - 19267427
Alignment:
| Q |
45 |
tggaaaaaagtgttatatgcttgctgctagatctctc |
81 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||| |
|
|
| T |
19267391 |
tggaaaaaagtgttacattcttgctgctagatctctc |
19267427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 20 - 88
Target Start/End: Original strand, 33137645 - 33137713
Alignment:
| Q |
20 |
agagctttcaattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctctccattg |
88 |
Q |
| |
|
|||||||||||||| | |||||| ||||| |||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
33137645 |
agagctttcaattgcacagaaagagtggacaaaagtgttacatgcttgctgctagatctctcaccattg |
33137713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000007; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 20 - 88
Target Start/End: Original strand, 17663866 - 17663934
Alignment:
| Q |
20 |
agagctttcaattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctctccattg |
88 |
Q |
| |
|
|||||||||||||| | |||||| ||||| | |||||||| |||||||||||||||||||| |||||| |
|
|
| T |
17663866 |
agagctttcaattgcaaagaaagagtggacagaagtgttacctgcttgctgctagatctctcaccattg |
17663934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 20 - 88
Target Start/End: Original strand, 19246367 - 19246435
Alignment:
| Q |
20 |
agagctttcaattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctctccattg |
88 |
Q |
| |
|
|||||||||||||| | |||||| ||||| | |||||||| |||||||||||||||||||| |||||| |
|
|
| T |
19246367 |
agagctttcaattgcaaagaaagagtggacagaagtgttacctgcttgctgctagatctctcaccattg |
19246435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 100
Target Start/End: Original strand, 898926 - 899006
Alignment:
| Q |
20 |
agagctttcaattggatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctctccattgcttggggtgatg |
100 |
Q |
| |
|
|||||||| |||||||||| || ||||||||| ||||| ||||||||||| ||||||||| ||||| ||| ||||||| |
|
|
| T |
898926 |
agagctttaaattggataggaaaagtggaaaaatatgttacatgcttgctgccagatctctcaccattcattgcggtgatg |
899006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 34 - 81
Target Start/End: Complemental strand, 38635374 - 38635327
Alignment:
| Q |
34 |
gatagaaagcgtggaaaaaagtgttatatgcttgctgctagatctctc |
81 |
Q |
| |
|
||||||||| |||||||||||||||| || |||||||||| ||||||| |
|
|
| T |
38635374 |
gatagaaagagtggaaaaaagtgttacattcttgctgctaaatctctc |
38635327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University