View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14398_high_15 (Length: 251)
Name: NF14398_high_15
Description: NF14398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14398_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 6315093 - 6314855
Alignment:
| Q |
1 |
tcattgttgtgcagttgttgatgacagtaaaaataaactctgcacatgatgaaaatgtcccctgcatgcgtttgaatttgaggtcataggtcactattcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6315093 |
tcattgttgtgcagttgttgatgacagtaaaaataaattctgcacatgatgaaaatgtcccctgcatgcgtttgaatttgaggtcataggttactattcc |
6314994 |
T |
 |
| Q |
101 |
cctaagctgttgtagtttcttgccattcaaagaagatatgccttaggaggtgctgtgtgtaggaagggaaagagtgacttctgtccctttttgcaatcca |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6314993 |
cctaagctgttgtagtctcttgccattcaaagaagatatgccttaggaggtgctgtgtgtaggaagggaaagagtgacttctggccctttttgcaatcca |
6314894 |
T |
 |
| Q |
201 |
cttgtgtgcttttaattccctaacggtcacaggttctgc |
239 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6314893 |
cttgtgtgcttttaattccctaacagtcacaggttctgc |
6314855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 4 - 140
Target Start/End: Complemental strand, 6318222 - 6318086
Alignment:
| Q |
4 |
ttgttgtgcagttgttgatgacagtaaaaataaa--ctctgcacatgatgaaaatgtcccctgcatgcgtttgaatttgaggtcataggtcactattccc |
101 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||| |||| |||||||||||| || ||| ||| ||||||||||| |||||||| ||||||| | | |
|
|
| T |
6318222 |
ttgttgtgcagctgttgatgacagtaaaattaaattctctccacatgatgaaactg--acctacatacgtttgaatttaaggtcatatttcactatactc |
6318125 |
T |
 |
| Q |
102 |
ctaagctgttgtagtttcttgccattcaaagaagatatg |
140 |
Q |
| |
|
| || || || ||| ||||| |||||||| |||||||| |
|
|
| T |
6318124 |
ccaaacttttatagcctcttggcattcaaacaagatatg |
6318086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University