View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14398_high_20 (Length: 226)
Name: NF14398_high_20
Description: NF14398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14398_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 18144938 - 18145134
Alignment:
| Q |
18 |
acaaacctatgtagcaccgacacttctactgaaagtgtgtctggtgttcgatgcgagtcgatgtcagacagtgacactacaccaacacatgttacaatca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18144938 |
acaaacctatgtagcaccgacacttctactgaaagtgtgtctggtgttcgatgcgagtcgatgtcagacagtgacactacaccaacacatgttacaatca |
18145037 |
T |
 |
| Q |
118 |
aaagaacaagtatacagtattcttataagatgtacctttttctgcatctttctgtttcgaagtttagcactttcttttcttgcattcgcctttgctt |
214 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
18145038 |
aaagaacaactatacagtattcttataagacgtacctttttctgcatcttcctgtttcgaattttagcactttcttttcttgcattcgccttggctt |
18145134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University