View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14398_high_5 (Length: 375)
Name: NF14398_high_5
Description: NF14398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14398_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 119 - 363
Target Start/End: Original strand, 1554285 - 1554529
Alignment:
| Q |
119 |
aactattatatgtttttatacactacttttgaagtccttatgtctactgtttacgtacttcaaactctttatattatgcaattatgacaattctcttatt |
218 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1554285 |
aactattatatgtttttatacagtacttttgaagtccttatgtctactgtttacgtacttcaaactctttatattatgcaattatgacaattctcttatt |
1554384 |
T |
|
| Q |
219 |
tgaagcaattagttgaattctctttcactttttggattgattggtttagttgaaaaagttcaaactcataacaccttctccattgtaatcaacattatta |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1554385 |
tgaagcaattagttgaattctctttcactttttggattgattggtttagttgaaaaagttcaaactcataacaccttctccattgtaatcaacattatta |
1554484 |
T |
|
| Q |
319 |
agttttaaaaagtggttattctctaaattagcttcctgacatcat |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1554485 |
agttttaaaaagtggttattctctaaattagcttcctgacatcat |
1554529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 199 - 241
Target Start/End: Original strand, 1550709 - 1550751
Alignment:
| Q |
199 |
attatgacaattctcttatttgaagcaattagttgaattctct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1550709 |
attatgacaattctcttatttgaagcaattagttgaattctct |
1550751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 126 - 199
Target Start/End: Original strand, 1550612 - 1550681
Alignment:
| Q |
126 |
atatgtttttatacactacttttgaagtccttatgtctactgtttacgtacttcaaactctttatattatgcaa |
199 |
Q |
| |
|
|||||||||| |||| ||||||||||||| | |||||| ||||||| |||||| |||||||||||||||||| |
|
|
| T |
1550612 |
atatgttttt-tacagtacttttgaagtcttcatgtct---gtttacgcacttcatactctttatattatgcaa |
1550681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University