View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14398_low_15 (Length: 282)
Name: NF14398_low_15
Description: NF14398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14398_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 59; Significance: 5e-25; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 210 - 268
Target Start/End: Complemental strand, 4062163 - 4062105
Alignment:
| Q |
210 |
acaagccatcttaattttataataatttcttctttatcttaaccaaagtaacacttgat |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4062163 |
acaagccatcttaattttataataatttcttctttatcttaaccaaagtaacacttgat |
4062105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 51 - 178
Target Start/End: Complemental strand, 4062293 - 4062160
Alignment:
| Q |
51 |
gttaaatccttaaatgaaacaatttctaattagattttatttaccgtttgactaaatttcaaatgacta-------tcaagaatcgaaaggttnnnnnnn |
143 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
4062293 |
gttaaatccttaaattaaacaatttctaattagattttatttaccgttcgactgaatttcaaatgactatataatctcaagaatcgaaaggtt-aaaaaa |
4062195 |
T |
|
| Q |
144 |
nnnntattgatatttaaacatcgaaatttagacaa |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4062194 |
aatatattgatatttaaacatcgaaatttagacaa |
4062160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University