View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14398_low_15 (Length: 282)

Name: NF14398_low_15
Description: NF14398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14398_low_15
NF14398_low_15
[»] chr4 (2 HSPs)
chr4 (210-268)||(4062105-4062163)
chr4 (51-178)||(4062160-4062293)


Alignment Details
Target: chr4 (Bit Score: 59; Significance: 5e-25; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 210 - 268
Target Start/End: Complemental strand, 4062163 - 4062105
Alignment:
210 acaagccatcttaattttataataatttcttctttatcttaaccaaagtaacacttgat 268  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4062163 acaagccatcttaattttataataatttcttctttatcttaaccaaagtaacacttgat 4062105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 51 - 178
Target Start/End: Complemental strand, 4062293 - 4062160
Alignment:
51 gttaaatccttaaatgaaacaatttctaattagattttatttaccgtttgactaaatttcaaatgacta-------tcaagaatcgaaaggttnnnnnnn 143  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||| |||| |||||||||||||||       |||||||||||||||||           
4062293 gttaaatccttaaattaaacaatttctaattagattttatttaccgttcgactgaatttcaaatgactatataatctcaagaatcgaaaggtt-aaaaaa 4062195  T
144 nnnntattgatatttaaacatcgaaatttagacaa 178  Q
        |||||||||||||||||||||||||||||||    
4062194 aatatattgatatttaaacatcgaaatttagacaa 4062160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University