View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14398_low_18 (Length: 249)
Name: NF14398_low_18
Description: NF14398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14398_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 30 - 241
Target Start/End: Original strand, 4062320 - 4062531
Alignment:
| Q |
30 |
gcatggatgagtggtttagatgatggcataacaaacgatagtgtaaatttgattgaaacagaaagaaaaatttgcaatatataaattgttgggttaagac |
129 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4062320 |
gcatggatgagcggtttagatgatggcataacaaacgatagtgtgtatttgattgaaacagaaagaaaaatttgcaatatataaattgttgggttaagac |
4062419 |
T |
 |
| Q |
130 |
tatgacaacgatatatactatattatgctctagagtttgtattaataattttctttgcatattttagtgctaaccttccggtcttatagatgtcatcttc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| ||||| || |||||||| |
|
|
| T |
4062420 |
tatgacaacgatatatactatattatgctctagagtgtgtattaataattttctttgcatatttaagtgctaaccttccggttttataaatttcatcttc |
4062519 |
T |
 |
| Q |
230 |
tatcatattctt |
241 |
Q |
| |
|
||||||| |||| |
|
|
| T |
4062520 |
tatcatactctt |
4062531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University