View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14398_low_21 (Length: 238)
Name: NF14398_low_21
Description: NF14398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14398_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 14 - 222
Target Start/End: Original strand, 1554739 - 1554947
Alignment:
| Q |
14 |
aaactttctatttctcctttcagcaagttaagttcaaaaggaacatatcctccaaataccttgtttatctatgagcagtcatttcttcatcactaagaaa |
113 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
1554739 |
aaactttctatttctcctttcaccaagttacgttcaaaaggaacatatcctccaaataccttgtttatttatgactagtcatttcttcatcactaagaaa |
1554838 |
T |
 |
| Q |
114 |
ccaagcctgcgcaaagaatttgctttaagcaaacattggcagatggtagaggatcgattaattttagcactaaccttcttaagggtatgtttgcatatta |
213 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1554839 |
ccaagcctgcgcaaagaatttgatttaagcaaacattggcagatggtagaggatcaattaattttagcactaaccttcttaagggtatgtttgcatatta |
1554938 |
T |
 |
| Q |
214 |
tttatttga |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
1554939 |
tttatttga |
1554947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University