View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14398_low_7 (Length: 366)
Name: NF14398_low_7
Description: NF14398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14398_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 349
Target Start/End: Original strand, 26921129 - 26921473
Alignment:
| Q |
1 |
tgaatttcttagcttatctaaggttcatgtaatatagtatattaaaacttgtaaatgaatatgctatatccaaggcgtttcattatgatacagcagccat |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
26921129 |
tgaatttcttagcttatctaagattcatgtaatatagtatattaaaacttgtaaatgaatatgcaatatccaaggcgtttcattatgatacagcagctat |
26921228 |
T |
 |
| Q |
101 |
acgtttacgattcttgagtgagaatcaggagattagtagttcagagttcacaccaaacaacattacggatggaaatggtagtatttggtcaggtagggta |
200 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26921229 |
acgtatacgattcttgag----aatcaggagattagtagttcagagttcacaccaaacaacattacggatggaaatggtagtatttggtcaggtagggta |
26921324 |
T |
 |
| Q |
201 |
ttaaaagtgcaatgtcatgttgcggatttgtctaggggttggtcgactctgtagcttgttcctagtcttcgtcctgttcgactgaggttgattgatcttg |
300 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26921325 |
ttaaatttgcaatgtcatgctgcggatttgtctaggggttggtcgactctgtagcttgttcctagtcttcgtcctgttcgactgaggttgattgatcttg |
26921424 |
T |
 |
| Q |
301 |
ataggaggcgaaatgattctctggttgtgttttaattttcgctcttgtt |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26921425 |
ataggaggcgaaatgattctctggttgtgttttaattttcgctcttgtt |
26921473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University