View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14399_high_10 (Length: 389)
Name: NF14399_high_10
Description: NF14399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14399_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-128
Query Start/End: Original strand, 92 - 376
Target Start/End: Original strand, 19493106 - 19493390
Alignment:
| Q |
92 |
tactagaaacactgcaacgtaacaaatacaacaaactaggagtatattactccggagtatatcatacctataataacaactagtttaaattgataattaa |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19493106 |
tactagaaacactgcaacgtaacaaatacaacaaactaggagtatattactccggagtatatcatacctataataacaactagtttaaattgataattaa |
19493205 |
T |
 |
| Q |
192 |
aactaacctaagcgaataacgctgaaacgttaccgaactgggagtagtatatacatatctattacgtattacttcaccatcacatttctcgtcaaactat |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19493206 |
aactaacctaagcgaataacgctgaaacgttaccgaactaggagtagtatatacatatctattacgtattacttcaccatcacatttctcgtcaaactat |
19493305 |
T |
 |
| Q |
292 |
ccttctctcacaaacaaaccctagcaatgactttccctcaagcnnnnnnnnnnnngaccctagcaatgactttgtctccaacttc |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
19493306 |
ccttctctcacaaacaaaccctagcaatgactttctctcaaacaaaaacaaaaaaaaccctagcaatgactttgtctccaacttc |
19493390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University