View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14399_low_12 (Length: 405)
Name: NF14399_low_12
Description: NF14399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14399_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 178 - 388
Target Start/End: Complemental strand, 42900211 - 42900001
Alignment:
| Q |
178 |
aaagttaaaattaatcagaagtctcaaacaataaactcattttgattggtacaaaaccttcgagtgtgtttgttttaaagtgtcatctcaaaacctcctt |
277 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||||| ||| |||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
42900211 |
aaagttaaaattaatcagaagtctcaaacgataaacccattttgattggtacagaactttcgagtgtgttcgtcttaaagtgtcatctcaaaacctcctt |
42900112 |
T |
|
| Q |
278 |
ttctttccttgtttggttgggggaggataaacctggtagaggattgaaacatttcacgctcctctctcaaatccagcccatcatgggcctcgacccttga |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42900111 |
ttctttccttgtttggttgggggaggataaccctggtagaggattgaagcatttcacgctcctctctcaaatccagcccatcatgggcctcgacccttga |
42900012 |
T |
|
| Q |
378 |
cacgtggtttt |
388 |
Q |
| |
|
||||||||||| |
|
|
| T |
42900011 |
cacgtggtttt |
42900001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 42900355 - 42900311
Alignment:
| Q |
18 |
atcagaggaggaacttatcaaagtaagacaacatatattagaaag |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42900355 |
atcagaggaggaacttatcaaagtaagacaacatatattagaaag |
42900311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University