View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14399_low_15 (Length: 348)
Name: NF14399_low_15
Description: NF14399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14399_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 19 - 339
Target Start/End: Original strand, 2793844 - 2794164
Alignment:
| Q |
19 |
tttacgagccaaagacgaaggaaactcgtgctgcttatgaggcgatgttgagtgtaatccagcagcggtttggtggtcagccgcttgggattatcagagg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2793844 |
tttacgagccaaagacgaaggaaactcgtgctgcttatgaggcgatgttgagtgtaatccagcagcggtttggtggtcagccgcttgggattatcagagg |
2793943 |
T |
|
| Q |
119 |
tgctgctgatgagattctttccattctgaaaaacgactctattggtgacaagaagattaacattgagaaactgcttaaccctatcactgatactgtgttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2793944 |
tgctgctgatgagattctttccattctgaaaaacgactctgttggtgacaagaagattaacattgagaaactgcttaaccctatcactgatactgtgttt |
2794043 |
T |
|
| Q |
219 |
aatcaccttgtttcgattggaaaggttataactgattttctggagtttgaggatgttgagggtggttttgattcttttgacggtgttgcagtggaatttg |
318 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2794044 |
aatcaccttgtttcgattggaaagcttataactgattttctggagtttgaggatgtggagggtggttttgattcttttgacggtgttgcagtggaatttg |
2794143 |
T |
|
| Q |
319 |
aagagaatgaagatgatgatg |
339 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2794144 |
aagagaatgaagatgatgatg |
2794164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University