View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14399_low_17 (Length: 279)
Name: NF14399_low_17
Description: NF14399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14399_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 8e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 92 - 260
Target Start/End: Original strand, 4064658 - 4064817
Alignment:
| Q |
92 |
acaaaatatacttgttggtaaccctaggtatagttctgttatactttcagtatgcctcgagtacaaaatagaactcatgttttgtcctgttctaacttgt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4064658 |
acaaaatatacttgttggtaaccctaggtatagttctgttatactttaagtatgcctcgagtataaaatagaactcatgttttgtcctgttctaacttgt |
4064757 |
T |
|
| Q |
192 |
ctatcaaacaccatcatagggtcgcttattggtatacacaatataattacttgtaccccaagatattgg |
260 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4064758 |
ctatca---------atagggtcgcttattggtatacacaatataattacttgtaccccaagatattgg |
4064817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 4064523 - 4064616
Alignment:
| Q |
1 |
aaagtgaggatgatttttgtgtgcgggtggggcgagggaggatgggcggtcaggcatggttataaaggggaggatgctttaggcactcgagaca |
94 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
4064523 |
aaagtgaggatgatttttgtgtgtgggtggggcgagggaggatgggcggtcaggcatggttatcaaggggaggatactttaggcactcgagaca |
4064616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University