View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14399_low_21 (Length: 268)
Name: NF14399_low_21
Description: NF14399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14399_low_21 |
 |  |
|
| [»] scaffold0364 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0364 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: scaffold0364
Description:
Target: scaffold0364; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 11163 - 11410
Alignment:
| Q |
1 |
ataccaatggaagcttaagaaataaagatatgggataacattattttatgtatttatttggatttcatcttaaaaggaccagacacaatagataaacttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11163 |
ataccaatggaagcttaagaaataaagatatgggataacattattttatgtatttatttggatttcatcttaaaaggaccagacacaatagataaacttg |
11262 |
T |
 |
| Q |
101 |
aataggaccaaacaacattactttgaatttgtgtctagtcatagatatttagctctttagtctttaccatgaatttttaacaagtaataatatatattca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11263 |
aataggaccaaacaacattactttgaatttgtgtctagtcatagatatttagctctttagtctttaccatgattttttaacaagtaataatatatattca |
11362 |
T |
 |
| Q |
201 |
ttttatatcatgcatatggcttggttatgttaactgtagaagtagaacaaat |
252 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11363 |
ttttatat----catatggcttggttatgttaaccgtagaagtagaacaaat |
11410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University