View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14399_low_24 (Length: 252)
Name: NF14399_low_24
Description: NF14399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14399_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 2280100 - 2279865
Alignment:
| Q |
1 |
tggtccctataaatgtctcaaattttgtttttcgtcattnnnnnnnttcaacaacttttggttcccaaatattttccgtcacggctttttgttcctattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
2280100 |
tggtccctataaatgtctcaaattttgtttttcgtcactaaaaaaattcaacaatttttggttcccaaatattttccgtcacagctttttgttcttattt |
2280001 |
T |
 |
| Q |
101 |
tttcgtcaactcatgtatatcctcacattattgaattaatttttaacaatgtatttagaatattataacaatttctttcataaaagttcatgatttcgtc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2280000 |
tttcgtcaactcatgtatatcctcacattattgaattaattttaaa-aatgtatttagaatattataacaatttctttcataaaagttcatgatttcgtc |
2279902 |
T |
 |
| Q |
201 |
cattttgctaactcaaactaaactctagagaaaattg |
237 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2279901 |
cattttgctaactcaagctaaactctagagaaaattg |
2279865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University