View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1439_high_10 (Length: 322)
Name: NF1439_high_10
Description: NF1439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1439_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 310
Target Start/End: Complemental strand, 8203083 - 8202770
Alignment:
| Q |
1 |
atagataataaaatacagtcatattttgtttttcagaccacacttcttgcaaataaaacatcataagctagcttgctaattctctacctagatggagagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8203083 |
atagataataaaatacagtcatattttgtttttcagaccacacttcttgcaaataaaacatcataagctagcttgctaattctctacctagatggagagt |
8202984 |
T |
 |
| Q |
101 |
ttggaaccaacttttggtttaatacgagattacaaactaattaaagcttaaataacaacttaacaagtgct----agctgcttaattaatttacaatgtc |
196 |
Q |
| |
|
||||||||||||| |||||||| || |||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8202983 |
atggaaccaactttaggtttaatgtgatattacaaactaattaaagctcaaataacaacttaacaagtgctagctagctgcttaattaatttacaatgtc |
8202884 |
T |
 |
| Q |
197 |
taattcaagcaaatttaacatgacattggttccattaattcagctgctcaaccaaggcgcaaatcgtcatttttgtaaccttcttctccatggtgatgag |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8202883 |
taattcaagcaaatttaacatgacattggttccattaattcagttgctcaaccaaggcgcaaatcgtcatttttgtaaccttcttctccatggtgatgag |
8202784 |
T |
 |
| Q |
297 |
gaagattctgatga |
310 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
8202783 |
gaagattcagatga |
8202770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University