View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1439_high_25 (Length: 218)
Name: NF1439_high_25
Description: NF1439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1439_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 80 - 141
Target Start/End: Original strand, 41180131 - 41180192
Alignment:
| Q |
80 |
gccggtagttgtatattagctagattttgtttgtttgttttcgaccacaacacaaacatata |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41180131 |
gccggtagttgtatattagctagattttgtttgtttgttttggaccacaacacaaacatata |
41180192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 140 - 197
Target Start/End: Original strand, 41180324 - 41180381
Alignment:
| Q |
140 |
tataatgtacataaatgcagtaaatatgtctcttctgctctttgttcactataatgcc |
197 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||| |||||||| ||||||||||| |
|
|
| T |
41180324 |
tataatgtacataaatacagtaaatatgtttcttctactctttgtcaactataatgcc |
41180381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University